miércoles, 2 de julio de 2008

VOLANDO,VOLANDO....



Como asi estoy,volando,volando....no os habia enseñado esta vidriera de mariposa que hice para el primer festival de patchwork de Sitges cuyo tema era primavera verano.
La hice toda a mano y la saqué de una foto pequeñita que vi en una revista Australiana y desde que la vi me tenia enamorada.Mide 1´25 x 1´25 cm.






El titulo que le puse fue:LAS MARIPOSAS SON PARA EL VERANO.




Bueno ya no os mareo mas con el futbol.....ahora tenis con Nadal y F-1 con Alonso...y el tour...y los safermines.....jejejeje...no,no...es broma.




Este blog es de patch y a eso me voy a dedicar....las que me habeis preguntado por el 2º bloque del DJ esta mas abajo y ahora los ire poniendo aquí al ladito...de momento.


Si teneis un momentito,espero que hagais una visita a este blog es de mi alumna Lidia que ya os ira poniendo las cosas que hace y que ha hecho tan preciosas.
Ahora los lunes cuando viene ademas de charlar de todo lo de clase,tenemos "tertulia bloguera"....y nos encanta.

39 comentarios:

Georgina dijo...

Lupe estoy sin palabras. Tu mariposa me apasiona, esos tonos púrpuras son divinos!!!! Yo soy muy de púrpuras también, algo que creo que somos muchas de las que hacemos patchwork. El otro día salí con unas amigas de aquí que hacen patch y claro fuimos a una tienda de telas....todas a la vez nos fuimos como imantadas a ver unas telas púrpuras que había expuestas... Y todas nos reimos a la vez de nuestro acto reflejo, jeje Bss.

Agus dijo...

Me acabo de quedar sin palabras, la mariposa es preciosa y los colores de las telas magnificos... por que nos gustara tanto el lila ...

Estoy enamorada de tu mariposa ...

Bss, Agus

SOGAMAR dijo...

Qué mariposa tan hermosa. Preciosa. Y las telas divinas.

tere dijo...

GUUUUAAAAAAAAAAUUUUUUUUUU QUE BONIC.... yo quiero¡¡¡¡ muackkkk

claudia dijo...

que divinaaaaaaaaaaa!!!!!!!!!!! esa mariposa me encanta es un tema pendiente para mi porque no se como se hacen besitosssssssssssssssssssssssssss

eva dijo...

La mariposa "lo mas"es preciosa
Me encanta que te gusten los Sanfermines ,de tu zona vienen muchos jóvenes ha correr el encierro,si lo quieres seguir mas de cerca puedes visitar esta página

http://www.fiestasdesanfermin.com/sf2003/index.asp

Estrella dijo...

Lupe espectacular esta mariposa. Yo las vidrieras aún mi asignatura pendiente

ANA dijo...

QUE CHULA!!!! YO SOY NOVATA EN VIDRIERAS,SOLO HE ECHO UNA Y ...NI LA HE COSIDO,PERO ME ENCANTAN!!!HAY!QUE NO TENDRAS TU POR AHI ESCONDIDO AUN,YO SAQUE CASI TODA LA ARTILLERIA CON MI "SITGES 2008" Y AHORA VOY A TENER QUE ENSEÑAR EL .....VAMOS QUE HARE UN INTERVIU COMO TU.
YA HACE TIEMPO QUE VISITO A LIDIA,LA ESTOY CONVENCIENDO PA QUE DEJE TUS CLASES Y SE VENGA A LAS MIAS JA,JA UN BESOTE ANA

elazafatedeemma dijo...

Que pasada de bonito, amiga cuanto trabajo, pero merecio la pena, es divino y los colores guapisimos, hay que quitarse el sombrero ante trabajos tan bonitos y tan bien realizados, un besin, Nieves

Blanca dijo...

Sólo le falta volar, es preciosa!

ANA dijo...

Hombre!! veo que has solucinado el problema de los enlaces !que bien!!,si es que hay que tener cuidado con el dedito...un besote Ana

Septiembre dijo...

BUeno, bueno, bueno.... estaba reservada por si ganaba la selección???
Impresionante... LupE, parece que va a echarse a volar y si vuela ten seguro que se posa en unas flores de mi casa... y entonces... será MIAAAA...
bESOS...

Inma dijo...

Te ha quedado preciosa, me encanta la elección de colores. Yo todavía no he hecho vidrieras, así que a ver si me animo viendo tu fantástico trabajo.

besos

Encarni dijo...

maravillosa mariposa, me encanta. enhorabuena. Saludos desde Granada...

Anna OP dijo...

es una papallona preciosa!!!! i quins colors, m'encanta.
ahir mateix parlava de papallones amb una amiga, que sempre que en veig alguna em fa posar de bon humor, son tan boniques... i per llàstima no s'en veuen gaires.
petonets,
anna

eva dijo...

Pesca submarina no lo se,pero seguro que se moja ,van a Galicia y anuncian un tiempo malisimo
ýo voy a Peñíscola
bss

tailes dijo...

Pues si en el blog es una pasada imaginarla en vivo y en directo.
Es magnífica!!!!

Sonia Facion dijo...

Lupe

Maravilhoso quilt!!!
Su trabajo es fantástico!!!
Te felicito!!!
Sonia - Brasil

IZAS dijo...

Hola Lupe!:
esta maripossa es fantástica!!!!!
Me encantan los colores!
Gracias por visitarme!
Besicos!:
IZas:)

Lorda dijo...

Gracias por tus animos, me han llegado como una energia positiva, para no parar de andar,Un abrazo. Lorda.

Noelia dijo...

Ohhh, qué bonita!!!
Me encantasn esos tonos lilas y morados, con el amarillo queda genial, además parece que esté en 3-D.

El título es de lo más apropiado!!

Un saludo y buen fin de semana :)

montse dijo...

Pero niña, que cosa más preciosa y yo sin enterarme. Es preciòs. M'agrada un munt. Te una feinada no???.
Un petó

Anónimo dijo...

hola soy Yesi de san juan de luz,pasaba para ver el quilt del botijo ycomo no esta,no lo has acabado?yo te puse que aqui era cruchón un botijo.
la mariposa es la mas bonita que he visto nunca de patch...impresiona,haces maravillas.
hasta pronto,Yesi.

Grazia dijo...

Wowwwwwwwwwwww Lupe!!!!!!!!!!
Es una maravilla!!!!!!
Que preciosidad!!!!!!!!!
Me encanta muchisimo!!!!!
Un abrazo
Grazia

MªÀngels dijo...

Una vidriera preciosa, i tota feta a mà!!!

Una meravella. M'encanta.

Emi dijo...

*La mariposa está soñada, es un excelente trabajo, a vos y a todos los Españoles mis felicitaciones por la Eurocopa...son maravillosos...
* Espero ver tu trabajo de la expo, me imagino la belleza, como todas las cosas que hacés...Lupe, mil gracias por tus palabras me hacen sentir muy bien, una de las amigas de mi hija le dice que tiene una mamá multifuncional,no es así ,pero intentó aprender un poco de todo, pero la verdad no muy afondo por que mi gran amor es muy egoísta y no me lo permite, hablo del QUILT.JAJAJA...Gracias de verdad, esas palabras tan lindas que viene de una persona tan especial, me llenan muchísimo...Hasta Pronto.

Con el cariño de siempre Emi.

Blanca R.C. dijo...

Pero vamos a ver ¿este glog no era de patchwork?, y ya se que en patchwork se hacen vidrieras, pero esta es imposible que este hecha de tela, esta tiene que ser de cristal emplomado y además dándole la luz por detrás. Es precioso, ahora en serio, cuango lo he visto he creído me ha parecido una de las vidrieras de patchwork más bonitas que he visto por que el juego de luces y sombras que has elegido y el uso del color hacen que sea muy hermoso.

Angelines Artero dijo...

Se me acaba de posar en el hombro, una maravilla. Besos

rosa dijo...

Aunque nos guste el patch, también nos emocionamos con la roja y con Nadal.
Qué bien !!!!
pasate por mi blog.
Enhorabuena porque eres una artista !!!

teodo dijo...

Lupe.....un lavoro stupendo, preciso e con dei bei colori.BRAVA!

Complimenti ai CAMPIONI d'EUROPA.
ciao ciao

corapensa.mjose dijo...

!PRECIOSA!no digo nada mas porque ya lo han dicho too

corapensa.mjose dijo...
Este comentario ha sido eliminado por el autor.
mariarrosa dijo...

¡Qué maravilla!

María Pilar dijo...

Que pretendes guapa que vuele yo como esa preciosa mariposa que has hecho?, pues creo que no porque aunque las tortugas vuelen, yo mas que tortuga soy tortugaza y es imposiblre que pueda volar, así que aunque lentamente intentaré levantar el culo de la silla y ponerme en movimiento, jeje. Un beso y una obra de arte tu trabajo.

yolanda dijo...

Felicidades es preciosa y comentarte que tengo una foto de ella hace mucho sin saber que era tuya,estoy enamorada de ella y algun dia me gustaria hacer algo que se le pueda parecer un poco ,por que seria imposible hacerla mejor y mas bonita .BESOS

ana-ane dijo...

Preciosa, me quedo sin palabras, fantástica

Silvana Gonzalez dijo...

Hola Lupe!!!
Que bella mariposa, es muy lindo hacer vitraux o vidriera, a mi lo que tenga que ver con el aplicado me fascina!!!!
Siempre es placer recorrer tu blog!!!
Te mando un abrazo....Silvana

Anónimo dijo...

Hola!! bueno tienes preciosidades hechas pero la mariposa me ha chiflado!!! Hay alguna posibilidad de poder conseguir las plantillas?
Dejo mi email por si alguien puede ayudarme dakotamaria_tf@hotmail.com
Muchisimas graciass

Pilar dijo...

Pasate por mi blog, creo que esto, te dejará más tranquila. No me gusta crear mal ambiente.Si borre tu comentario no fue con ánimo de ofenderte. Un abrazo.

Related Posts with Thumbnails